Functional identification of genes responsible for the biosynthesis of 1-methoxy-indol-3-ylmethyl-glucosinolate inBrassica rapassp.chinensis

Background

Brassicavegetables contain a class of secondary metabolites, the glucosinolates (GS), whose specific degradation products determine the characteristic flavor and smell. While some of the respective degradation products of particular GS are recognized as health promoting substances for humans, recent studies also show evidence that namely the 1-methoxy-indol-3-ylmethyl GS might be deleterious by forming characteristic DNA adducts. Therefore, a deeper knowledge of aspects involved in the biosynthesis of indole GS is crucial to design vegetables with an improved secondary metabolite profile.

Results

Initially the leafyBrassicavegetable pak choi (Brassica rapassp.chinensis) was established as suitable tool to elicit very high concentrations of 1-methoxy-indol-3-ylmethyl GS by application of methyl jasmonate. Differentially expressed candidate genes were discovered in a comparative microarray analysis using the 2 × 104 K formatBrassicaArray and compared to available gene expression data from theArabidopsisAtGenExpress effort.Arabidopsisknock out mutants of the respective candidate gene homologs were subjected to a comprehensive examination of their GS profiles and confirmed the exclusive involvement of polypeptide 4 of the cytochrome P450 monooxygenase subfamily CYP81F in 1-methoxy-indol-3-ylmethyl GS biosynthesis. Functional characterization of the two identified isoforms coding for CYP81F4 in theBrassica rapagenome was performed using expression analysis and heterologous complementation of the respectiveArabidopsismutant.

Conclusions

Specific differences discovered in a comparative microarray and glucosinolate profiling analysis enables the functional attribution ofBrassica rapassp.chinensisgenes coding for polypeptide 4 of the cytochrome P450 monooxygenase subfamily CYP81F to their metabolic role in indole glucosinolate biosynthesis. These new identifiedBrassicagenes will enable the development of genetic tools for breeding vegetables with improved GS composition in the near future.

Glucosinolates (GS) are amino acid-derived nitrogen- and sulphur-containing plant secondary metabolites characteristic for most families of the order Brassicales [1,2]. Altogether there are about 200 known naturally occurring GS structures [3,4], of which various ecotypes of the model organismArabidopsis thalianahave about 40 [5]. Depending on the amino acid precursor GS could be divided into three groups: (i) aliphatic GS derived from leucine, isoleucine, valine, and methionine; (ii) aromatic GS derived from phenylalanine and tyrosine; and (iii) indole GS derived from tryptophan. The biosynthesis of GS proceeds through three separate phases, the chain elongation of selected precursor amino acids, the formation of the core GS structure, and finally modifications of the side chain. Several genes of the biosynthetic network and key regulators for GS present inArabidopsisare known [6,7]. The formation of the GS core structure is widely elucidated and genes responsible for secondary modifications of aliphatic GS via oxygenations, hydroxylations, alkenylations and benzoylations have been identified [8]. Indole GS can undergo hydroxylations and methoxylations, with CYP81F2 identified as the gene responsible for 4-hydroxylation of indol-3-ylmethyl GS (I3M) inArabidopsis[9–11] (Figure1), together with further members of the CYP81F family ofArabidopsis thalianaas being involved in 4-hydroxylation of indol-3-ylmethyl GS and/or 1-methoxy-indol-3-ylmethyl GS biosynthesis [12]. When tissue is damaged, the thioglucoside linkage of GS is hydrolyzed by myrosinases, enzymes that are spatially separated from GS in intact tissue. In the presence or absence of specifier proteins the degradation results in the formation of a variety of hydrolysis products [13].

The different groups of GS and their various degradation products are extensively studied metabolites. It has been shown that genes encoding enzymes of the specific glucosinolate biosynthesis pathways form stable co-expression clusters [15], and group together with tryptophan biosynthetic genes in response to stress conditions [16]. With respect to plant fitness they play important roles in plant defence against herbivores [17] and pathogens [9], and also abiotic stresses like UV-B irradiation specifically changes the GS profile [18]. In addition, there is increasing evidence that evolutionary and ecological forces shape polymorphism at loci involved in the GS-myrosinase defence system [19].

Brassica蔬菜种植和消费的世界nd represent a highly important component in the human diet [20]. Their content of GS is varying dependent on genotype, development and environmental conditions [21] while the composition of GS and their respective degradation products is a major determinant of the characteristic flavor and smell ofBrassicavegetables [22]. In addition, the secondary metabolites and their respective degradation products are believed to have protective cancer-preventing activity in higher animals and humans [23,24]. However, recent studies also provide evidence that juices of Brassicaceae might also be mutagenic because they form characteristic DNA adducts in bacteria and mammalian cells [25]. It is namely the 1-methoxy-indol-3-ylmethyl GS and its degradation products that have been shown to exert these negative effects [26,27].

With this study new genes where identified that are involved in the biosynthesis of indole GS, namely the synthesis of 1-methoxy-indol-3-ylmethyl GS with focus onBrassicavegetables. After establishing the leafyBrassicavegetable pak choi (Brassica rapassp.chinensis) as suitable tool to elicit very high concentrations of 1-methoxy-indol-3-ylmethyl GS by application of methyl jasmonate (MeJA) [28] the identification of genes involved in this process was possible by comparing expression pattern in pak choi using the 2 × 104 K formatBrassica数组与公开的基因表达数据from theArabidopsisAtGenExpress effort [29]. With the functional characterization of the identified genes new genetic tools for breeding healthy vegetables with improved GS composition will be possible in the near future.

Increased indole GS biosynthesis in pak choi treated with methyl jasmonate

In a previous study it was shown that different cultivars of the leafy vegetable pak choi (Brassica rapassp.chinensis) contain a certain amount of indole GS in their green leaf tissue [30]. The different cultivars can be classified in distinct groups depending on their GS profiles, which are partly linked to the expression of specific genes involved in the aliphatic GS biosynthetic pathway. In a related study it was further demonstrated that a small set of elicitors known to induce GS biosynthesis in various organism is also functional in pak choi [28]. Amongst others it was namely methyl jasmonate (MeJA) that led to an increase of indole GS biosynthesis. In order to further characterize this induction of GS biosynthesis in pak choi seedlings in more detail a concentration series ranging from 100 μM to 3 mM was applied and GS accumulation was measured 48 hours after application (Additional file1: Table S1). As shown in Figure2A a doubling of specific aliphatic GS could be achieved when applying concentrations of more than 750 μM MeJA, and also the amount of the aromatic 2-phenylethyl GS was increased up to 3fold at such high concentrations applied. As expected, indole GS accumulation was more sensitive to the MeJA application, and the indole GS level was elevated even when the lowest concentration of 100 μM was used (Figure2B). With the application of higher concentrations of MeJA up to 2 mM a further increase of indole GS levels could be achieved until no additional elevation was detected. Notably it was mainly the 1-methoxy-indol-3-ylmethyl GS that was increased up to 30fold in pak choi seedlings after treatment with MeJA.

It is known for a long time that jasmonate, ethylene and salicylic acid upregulate the expression of scores of defense-related genes [31], and our knowledge of the complex network of jasmonate signaling in stress responses and development including hormone cross-talk is continuously increasing [32,33]. With respect to plant resistance GS present classical examples of compounds affecting insect-plant interactions [17] in which the GS-myrosinase defence system is also evolutionary and ecological modulated [19]. In terms of plants defense against pathogens it is further suggested that tryptophan-derived metabolites may act as active antifungal compounds [9,34]. Against this background the induced GS biosynthesis was strongly expected in pak choi after treatment with MeJA.

Specific induction of 1-methoxy-indol-3-ylmethyl GS in pak choi seedlings

In order to analyze the specificity of the increased indole GS biosynthesis in more detail a similar experiment withArabidopsisseedlings was performed using MeJA concentrations ranging from 200 μM up to 5 mM. As evident from Figure3MeJA application also increased indole GS content inArabidopsis(Additional file1: Table S2). However, the increase was much lower in this plant species, and the major elevation was found in the non-methoxylated indol-3-ylmethyl GS. Further experiments demonstrated that pak choi seedlings exert stronger rise of indole GS levels upon MeJA application than adult plants [28], while inArabidopsisno differences in the elevation between seedlings and adult rosette leaves were detectable (data not shown). This comparison withArabidopsis thalianaCol-0 ecotype clearly revealed that a very strong raise of 1-methoxy-indol-3-ylmethyl GS is specific to pak choi. The unambiguous difference between seedlings of pak choi andArabidopsisdiscovered in this glucosinolate profiling analyses was used in further experiments to identify related genes involved in 1-methoxy-indol-3-ylmethyl GS biosynthesis ofBrassica rapassp.chinensis.

Identification of candidate genes using gene expression analysis with the Brassica microarray

As strong induction of 1-methoxy-indol-3-ylmethyl GS was found 48 hours after application of 2 mM MeJA to pak choi seedlings gene expression differences to control treatments were analyzed in these samples using theBrassicamicroarray. In order to get maximum amount of information the 2 × 104 K array was chosen in the investigation. The elements on theBrassicaarray were identified by their homology to known genes ofArabidopsis thalianaand were classified to respective bins using MapMan [35] and Mercator [36]. As expected when MeJA was applied to plant seedlings, defense related genes showed the most significantly changed transcript levels (Table1). With respect to a putative function in GS metabolism [37] the genes with highest expression differences are listed in Table2. Mainly the transcripts of genes putatively involved in GS degradation were induced, but also genes involved in indole GS core structure formation were strongly elevated and among the most significantly changed. The increased expression of genes specifically involved in indole GS core structure biosynthesis reflects the elevation of indole GS levels. Among the most significantly altered transcripts candidates were selected that are putatively involved in side chain modification of indole GS biosynthesis, namely those that show typical structures of the large gene families of cytochrome P450 monooxygenases orO-methyltransferases (Table2).

这些选中的候选人进一步评估regarding respective expression differences of the related homologs in availableArabidopsis thalianamicroarray hybridization experiments using the Genevestigator database [38]. As shown in Table3theArabidopsishomologs of the selected genes involved in GS metabolism were found responsive to MeJA treatments with log2-ratios being 1 or greater. This is in good agreement with the reported modulation of the GS profile inArabidopsisby defense signaling pathways [39] and is also reflected in results presented in Figure3. TheArabidopsis选定的候选基因的同源染色体显示strong variation in their responsiveness to MeJA. WhileAt3g28740(CYP81D11) andAt5g36220(CYP81D1) were strongly induced by MeJA application,At4g37410(CYP81F4),At4g37430(CYP81F1) andAt5g42590(CYP71A16) were only weakly influenced, whileAt4g35160(OMT) andAt1g13080(CYP71B2) showed unchanged expression. AsAt1g13080,At5g42590andAt3g28740were already expected to be involved in other metabolic pathways we concentrate in further experiments onAt4g37410andAt4g37430as genes putatively involved in GS metabolism, and onAt4g35160andAt5g36220without any linked pathway identified so far.

GS profiling inArabidopsismutants with knock out of the respective candidate gene homologs

In order to verify a putative involvement of the selected candidate genes in indole GS biosynthesis respectiveArabidopsisknock out mutants were profiled for their GS accumulation. Since there are tissue specific differences in the proportional distribution of individual GS with indole GS being mainly present in either roots or old leaves [40] plants were grown in tissue culture and leaves and roots analyzed separately, or GS profiles of leaves of flowering plants grown in the greenhouse were measured (Additional file1: Table S3). As evident from Table4there is one of the four selectedArabidopsis没有产生1-methoxy-i敲除突变体ndol-3-ylmethyl GS in any of the tissues analyzed. This confirms the expectation that theArabidopsisgene product ofAt4g37410(CYP81F4) is needed in leaves and roots to synthesize 1-methoxy-indol-3-ylmethyl GS [12,41]. The absence of a metabolic phenotype on GS level in the selectedArabidopsismutant with knock out in the selectedO-methyltransferase (Atomt) further shows that at least inArabidopsisthere are otherO-methyltransferases present which could contribute to the synthesis of 1-methoxy-indol-3-ylmethyl GS in leaves. Consequently, it needs to be analyzed whether theO-methyltransferase activity is provided through IGMT5 (At1g76790) anO-methyltransferase family protein that is strongly co-expressed withAt4g37410(CYP81F4) as determined using the ATTED-II coexpression database [42]. In addition, inArabidopsisthere are further members of theO-methyltransferase family, IGMT1 (At1g21100), IGMT2 (At1g21120) and IGMT4 (At1g21130), that are coexpressed withAt5g57220(AtCYP81F2). At least in an artificial expression system usingNicotiana benthamianait has been shown that IGMT1 and IGMT2 can be employed forO-methylation of indole GS [12].

正如先前所显示的有一定的增加indole GS biosynthesis inArabidopsisafter application of MeJA (Figure3). Therefore, the selected knocks out mutants of genes responsive to MeJA treatment (Table3) were also analyzed after application of this elicitor. While mutants in AtCYP81F1 and AtCYP81D1 showed a comparable increase of indole GS biosynthesis as the treated control plants (Table5), the mutant in AtCYP81F4 did not accumulate any 1-methoxy-indol-3-ylmethyl GS while an expected increase of the precursor indol-3-ylmethyl GS could be observed 48 hours after MeJA application in this mutant. This finally confirms that the gene product ofAt4g37410, the cytochrome P450 monooxygenase 81F4 is utterly necessary to synthesize 1-methoxy-indole-3-ylmethyl GS inArabidopsisat standard growth conditions. It additionally demonstrates that there is none of the other P450 monooxygenase 81F family proteins involved in 1-methoxy-indole-3-ylmethyl GS synthesis even under conditions of increased biosynthesis when defense related pathways are induced.

Arabidopsisecotype Wu-0 without 1-methoxy-indol-3-ylmethyl GS accumulation

Further evidence of the importance ofAt4g37410(CYP81F4) for 1-methoxy-indol-3-ylmethyl GS biosynthesis is coming from a survey of the GS content in leaves and roots of the 19 key accessions [43] used to develop the MAGIC lines [44]. A total of 20 distinct GS could be identified and quantified by Witzel and co-workers, with most of the aliphatic GS showing accession-specific distribution while the indole GS were present in almost all 19 accessions [43] with one exception: ecotype Wu-0 did not contain 1-methoxy-indol-3-ylmethyl GS in any tissue analyzed. Since the corresponding whole genome sequences of all 19 accessions are available [45] the respective sequence variants at locusAt4g37410(http://mus.well.ox.ac.uk/19genomes/variants.tables/) were inspected for the presence of relevant polymorphisms. Indeed, at bp coordinate 18595917 in the pseudo genome and bp coordinate 17592444 of the Col-0 reference genome on chromosome 4 the insertion of one C nucleotide could be found solely in the accession Wu-0. This insertion produces a frame shift in the coding sequence thus disrupting CYP81F4 and leading to an altered protein sequence from amino acid 390 with a premature stop at amino acid 395. In contrast, the putative functional protein is composed of 501 amino acids in all other accessions that produce 1-methoxy-indole-3-ylmethyl GS. In summary this is an excellent example were publicly available sequence data together with comprehensive metabolite profiling enables the identification of a gene that is putatively involved in the respective metabolic pathway at question. In addition, since the ecotype Wu-0 is anArabidopsisaccession collected from Germany the presence of 1-methoxy-indol-3-ylmethyl GS does not seem to be essential for survival of this ecotype in its natural habitat. As shown previously defense related co-expression networks inArabidopsis thalianagroup together with tryptophan and GS biosynthesis genes in response to stress conditions [16]. Thus, the increase of indole GS biosynthesis inArabidopsisand the relatively small accumulation of 1-methoxy-indol-3-ylmethyl GS when compared toBrassica rapassp.chinensisrevealed that this specific indole GS might not play a pivotal role in stress response inArabidopsis thaliana.

Characterization of the CYP81F4 genes identified in theBrassica rapagenome

It was already shown that genes involved in the GS biosynthesis exist in more than one copy in theBrassica rapagenome accession Chiifu-401-42 [37]. Besides this there is also a high co-linearity when compared toArabidopsis thaliana.This co-linearity is similarly found for AtCYP81F4 (At4g37410) surrounded by AtCYP81F3 (At4g37400) and AtCYP81F1 (At4g37430) onArabidopsischromosome 4. When compared toArabidopsis At4g37410two different orthologues of theBrassica rapaaccession Chiifu-401-42 on BAC clones KBrB006J12 and KBrH064I20 could be identified: While KBrB006J12 corresponds to a region on chromosome A01, no match for KBrH064I20 has been found so far. On KBrB006J12 the orthologue to AtCYP81F4 was identified as Bra011759 (BrCYP81F4-1) on the reverse strand on chromosome A01, and is preceded by Bra011758 orthologous to AtCYP81F3 and followed by Bra011761 orthologous to AtCYPF1. On KBrH064I20 the orthologue to AtCYP81F4 was named BrCYP81F4-2, and is preceded by another orthologue to AtCYP81F3 while the following sequence orthologous to AtCYPF1 is corrupted.

In order to analyze the tissue specific expression of the selected genes in more detail isoform specific primer pairs were developed using the respective sequences of theBrassica rapaaccession Chiifu-401-42 BAC clones KBrB006J12 and KBrH064I20. Semi-quantitative realtime RT-PCR analysis was performed with cDNA synthesized from RNA isolated from 12 days old seedlings, and leaves and roots of six weeks oldBrassica rapassp.chinensisplants. As evident from Table6expression of all selected genes could be detected in pak choi. In most cases a higher expression was found in leaves than in seedlings and onlyBrCYP81F4-1is expressed at a higher level in roots than in leaves. The highest expression level in leaves was detected forBrCYP81F4-2whileBrCYP81F4-1was the main expressed isoform in roots. This already indicates that theBrCYP81F4isoforms may play an important role on a tissue-specific level and during development at standard growth conditions.

Further expression analysis was performed with different tissues of pak choi treated with 500 μM MeJA. Expression analysis confirmed induction of mainly the two identifiedBrCYP81F4genes inBrassica rapassp.chinensisseedlings, leaves and roots treated with MeJA (Table6). Since there was some increased expression also detectable for other isoforms seedlings of pak choi were treated with a series of different concentrations of MeJA and expression differences to control treatment were analyzed for allBrCYP81F(Figure4). This unequivocally confirms that bothBrCYP81F4isoforms were most responsive to the elicitor treatment while the others did not show comparable sensitivity to this elicitor. Application of 100 μM MeJA already elevated the expression ofBrCYP81F4-1andBrCYP81F4-24fold with highest increase ofBrCYP81F4-2of more than 64fold after application of 2 mM MeJA. This confirms that the two isoforms ofBrCYP81F4are the candidate genes fromBrassica rapassp.chinensisthat are crucial for 1-methoxy-indol-3-ylmethyl GS biosynthesis.

Jasmonic acid signaling is a central component of inducible plant defense and the expression of jasmonate-induced responses are tightly regulated by the ecological background of the plant [46] and also by the plant species itself. While inArabidopsis thalianatryptophan and GS biosynthesis genes respond to stress conditions [16] there is only relatively small accumulation of 1-methoxy-indol-3-ylmethyl GS when compared toBrassica rapassp.chinensis. The role of this distinct response to the elicitor and differences in accumulation of a specific defense compound will be the subject of future analysis in an ecological context.

Functional identification of BrCYP81F4 isoforms for biosynthesis of 1-methoxy-indol-3-ylmethyl GS

In order to finally assess BrCYP81F4 isoform function full length cDNAs of both genes were amplified and heterologously expressed in theArabidopsis thalianamutantAtcyp81f4, which does not produce 1-methoxy-indol-3-ylmethyl GS. Using oligonucleotide primers developed with theBrassicaA genome sequence fromBrassica rapaaccession Chiifu-401-42 [37] two full length cDNA sequences fromBrassica rapassp.chinensiscoding for putative BrCYP81F4 isoforms were amplified. Both sequences show 90.7% pair-wise identities and code for proteins of 501 amino acids with 93% similarity. Compared to theArabidopsisprotein similarities of 85.4% and 90.2% could be calculated. The sequences of interest (BrCYP81F4-1andBrCYP81F4-2) were recombined into the plant expression vector pK7WG2 [47] andAgrobacteriummediated gene transfer was performed using the knock out mutantAtcyp81f4as the host. Kanamycin resistant seedlings of the T2 generation were selected and analyzed for heterologous gene expression and GS accumulation. As shown in Table7expression of both cDNAs from pak choi in theAtcyp81f4mutant background led to metabolic complementation with accumulation of 1-methoxy-indol-3-ylmethyl GS in leaves and a reduced level of I3M when compared to the mutant without expression of theBrassica rapassp.chinensisgenes. Although the identical heterologous expression system was used, BrCYP81F4-2 led to much higher accumulation of 1-methoxy-indol-3-ylmethyl GS. Whether this difference is caused by a higher protein level of the heterologous enzyme in the mutant plant background or is linked to advanced enzyme activity will be the topic of further studies. Another interesting point here is the significant decrease of I3M in theAtcyp81f4mutant background when the highly active BrCYP81F4-2 is expressed. In summary the level of indole GS stayed constant in these plants demonstrating unaltered total flux into the indole GS pathway thus indicating no further metabolic regulation by the end products.

In conclusion this is an explicit example were elicitation of a specific metabolic difference and subsequent comparative microarray analysis together with focused metabolite profiling permits the targeted discovery of genes involved in the respective metabolic pathway. Here this enables the functional attribution of new identifiedBrassica rapassp.chinensisgenes to their metabolic role in indole glucosinolate biosynthesis that in the near future will contribute to develop new genetic tools for breeding vegetables with improved glucosinolate profile.

Plant material

Seeds ofBrassica rapassp.chinensis(pak choi)品种黑Behi(盟军的植物,Quezon City, Philippines) were sown on bars of fleece, 3 g seeds of pak choi, placed in aluminum foil trays (33 × 10 cm) filled with perlite. Trays were kept in a greenhouse chamber at 12 h photoperiod (220 μmol m^-2s^-1光合有效辐射的)和温度e regime of 24/20°C (day/night) at relative humidity about 75% for 10 days. The seedlings were watered as needed, no fertilizer was added. To obtain soil grown plants seedlings were germinated and grown on soil at 10 h photoperiod (photon flux density 150 μmol m^-2s^-1, 22°C light, 20°C dark).

Arabidopsis thalianaL. Heynh Columbia-0 (Col-0), SALK_024438 (Atcyp81f4), SALK_031939 (Atcyp81f1), SALK_005073C (Atcyp81d1), and SALK_053994 (Atomt) were obtained from Nottingham Arabidopsis Stock Centre (University of Nottingham, Loughborough, United Kingdom). Seeds were surface sterilized and aseptically grown on ½ strength MS medium including vitamins [48], 0.5% sucrose and 0.7% agar. For elicitor treatment 20 mg of Col-0 seeds were spread per petri dish and grown in a greenhouse at 16 h photoperiod (photon flux density 250 μmol m^-2s^-1) for 10 days. In all other cases seeds were imbibed at 4°C darkness (48 h) and grown in 10 h photoperiod (photon flux density 150 μmol m^-2s^-1, 21°C). To obtain soil grown plants seedlings were transferred after three weeks to soil at 10 h photoperiod (photon flux density 150 μmol m^-2s^-1, 22°C light, 20°C dark).

Elicitor treatment

Methyl jasmonate (Sigma Aldrich, Seelze, Germany) was resolved in water containing 0.01% (v/v) Tween20 to reduce surface tension and water containing 0.01% (v/v) Tween20 was sprayed as control treatment. The 10 days old pak choi seedlings were treated by spraying each bar of fleece with 15 ml of the respective solution. The 10 days oldArabidopsisseedlings were treated by spraying each petri dish with 2 ml of the respective solution. 48 hours after treatment the total aerial tissue was harvested. Samples were quickly frozen in liquid nitrogen, subsequently lyophilized, and blended to a fine powder. For each treatment, at least three samples were taken as replicates.

Sample preparation and desulfo-glucosinolate analysis by HPLC

Glucosinolate concentration was determined as desulfo-glucosinolates according to Wiesner et al. [30]. Briefly, 20 mg of powdered samples were extracted and analyzed by HPLC using a Merck HPLC system (Merck-Hitachi, Darmstadt, Germany) with a Spherisorb ODS2 column (Bischoff, Leonberg Germany; particle size 5 μm, 250 mm × 4 mm). Desulfo-glucosinolates were identified based on comparison of retention times and UV absorption spectra with those of known standards. Glucosinolate concentration was calculated by the peak area relative to the area of the internal standard. Each replicate sample was measured in duplicate. Results are given as μmol g^-1dry weight.

Microarray analysis

The microarray analysis was performed as described [18]. Briefly, frozen pak choi sprout material was ground in liquid nitrogen in an orbital ball mill for 2 min at a frequency of 30 Hz s^-1(MM400 Retsch GmbH, Haan, Germany). Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany), including the on-column DNase digestion step with the RNase-free DNase Set (Qiagen). The microarray analysis was done with 1 mg of total RNA isolated from each of three replicates of methyl jasmonate treated and control treated seedlings. Agilent One-Color Gene Expression Microarray analysis following the recommendation of MIAME (http://www.mged.org) was performed at Beckman Coulter Genomics (Morrisville, NC, United States,http://www.beckmangenomics.com/) using the 2 × 104 k formatBrassicaArray [49];http://brassica.bbsrc.ac.uk/). Microarray data are available in the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress) under accession number E-MTAB-2386. The Open Source Microarray Processing Software Robin (http://mapman.gabipd.org/web/guest/home) was used to evaluate and calculate results of the log fold change of expression in MeJA treated seedlings in relation to the control [35]. The assignment of the different genes was done by comparison of the translated protein sequences of the 95 kBrassicaunigene set with theArabidopsisTAIR9 database using the Mercator pipeline for automated sequence annotation [36] (http://mapman.gabipd.org/web/guest/app/mercator). For each identifier the gene with the highest homology was provided with identifier and description. The respective bitscores were classified as follows: very weakly similar (bitscore smaller than 100); weakly similar (bitscore 101–200); moderately similar (bitscore 201–500); highly similar (bitscore greater than 500).

Isolation of mutants

Plants were obtained from the Salk collection [50]. Screening and selection within mutant populations was done following the Signal Salk instructions (http://signal.salk.edu). Genomic DNA was isolated by a standard procedure using NucleoSpin PlantII (Macherey-Nagel GmbH & Co. KG, Dueren, Germany). PCR genotyping was performed using the T-DNA LB-specific primer SALK LBb 5′-GCGTGGACCGCTTGCTGCAACT and the gene-specific primer pairs of Atcyp81f4l2 5′- AGGGTATTCGTTTTGGAGCA, Atcyp81f4r2 5′- CTTCTCCACCGTTGAACCTC; Atcyp81f1l2 5′- CTCCAACGAAAGCAACGATT, Atcyp81f1r2 5′- CGAGCATCATCGACTTCACA; Atcyp81d1l 5′- TGCCCATTCTAGAGTGACTGC, Atcyp81d1r 5′- AGAATGATGACCGGAAAACG; Atomtl 5′- CAAGTATTCCCATCGTCTCTCC, Atomtr 5′- ATTGAAAACCATCCTTCGTCAC. Homozygous mutants were isolated from selfed populations of the respective mutant. Gene knock-out was proven by semi-quantitative realtime RT-PCR.

Gene expression analysis by semi-quantitative realtime RT-PCR

RNA was extracted from 100 mg tissue using the NucleoSpin Plant Kit (Macherey-Nagel GmbH and Co KG), including on-column DNaseI digestion. RNA was quantified spectrophotometrically at 260 nm (Nanodrop ND1000, Technology Inc., USA), and quality was checked using the ratio of absorption at 260 and 280 nm with a ratio between 1.9 and 2.1 as acceptable. Single-stranded cDNA synthesis was carried out with total RNA using SuperScript™ III RNaseH–reverse transcriptase (Invitrogen, Life Technologies GmbH, Darmstadt, Germany) with oligo d(T_12–18) primers according to the manufacturer’s instructions. PCR amplified sequences generated with these oligonucleotide primer pairs and cDNA from pak choi leaves as template were subcloned and verified by sequence analysis. Semi-quantitative two-step RT-PCR was performed using a SYBR® Green 1 protocol in 96-well reaction plates on an Applied Biosystems 7500 Realtime PCR System. The following thermal profile was used for all reactions: 50°C for 2 min, 95°C for 10 min, 40 cycles of 95°C for 30 s and 60°C for 1 min, followed by dsDNA melting curve analysis to ensure amplicon specificity. Each reaction was done in a 10 μl volume containing 200 nM of each primer, 3 μl of cDNA (1:50) and 7 μl of Power SYBR Green Master Mix (Applied Biosystems, Life Technologies, Carlsbad, CA, USA). Data generated by semi-quantitative real-time PCR were collected and compiled using 7500 v2.0.1 software (Applied Biosystems). Data were exported to LinReg software [51] to determine the PCR amplification efficiency for each primer pair. Relative transcript levels ofArabidopsis thalianawere normalized on the basis of expression ofAt3g18780(ACT2), and relative transcript levels ofBrassica rapawere normalized on the basis of expression of an invariant control orthologous toAt3g18780on KBrB071H12 by calculating ΔCt, the difference between control and target products (ΔCt=Ct_gene–Ct_act)[52]. Semi-quantitative PCR was performed on at least three biological replicates measured in duplicates for each gene, and non-template controls were included. Gene-specific primer sets are listed in Table8.

Cloning procedures and plant transformation

All constructs have been made using a combination of TOPO® and GATEWAY® cloning system (Invitrogen).Brassica rapasubsp.chinensissequences coding for the two identified, putative CYP81F4 were amplified using the Advantage® 2 PCR Kit (Clontech, Takara Bio Company, Kyoto, Japan) and primer pairs BrF4-1fg 5′- CACCATGTTCTACTATGTGATACTCCCT and BrF4-1ro 5′- AACCTTTGAGTCGGTAACAA; as well as BrF4-2fg 5′- CACCATGTTTTACTATGTGATTCTCCCT and BrF4-2ro 5′- AACTTTTGACTCGGTAAGAA. PCR products were inserted into the entry vector pENTR™/SD/D-TOPO® (Invitrogen), and verified by sequencing (LGC Genomics GmbH, Berlin, Germany). Both sequences of interest (BrCYP81F4-1(Accession KF612589) andBrCYP81F4-2(Accession KF612590)) were then recombined into the appropriate destination vector pK7WG2 [47] using GATEWAY® LR Clonase™ II enzyme mix according to the manufactures instructions (Invitrogen).Agrobacteriummediated gene transfer was performed according to [53] using two homozygous lines (M3-1, M3-6) of the knock out mutantAtcyp81f4as the host. Kanamycin resistant seedlings of the T1 generation were selected and expression of the respective transgene was recorded by semi-quantitative realtime RT-PCR.

We gratefully acknowledge the excellent technical assistance from Andrea Maikath and Andrea Jankowsky.

Affiliations

1. Leibniz-Institute of Vegetable and Ornamental Crops Grossbeeren and Erfurt e.V., Theodor-Echtermeyer-Weg 1, Grossbeeren, 14979, Germany

   Melanie Wiesner, Monika Schreiner & Rita Zrenner

Corresponding author

Correspondence toRita Zrenner.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

RZ and MS designed the study, MW carried out the elicitor treatments and the metabolite and molecular analyses, RZ carried out the molecular and genetic studies, RZ wrote the manuscript. All authors read and approved the final manuscript.

Open AccessThis article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions