TheArabidopsis thalianaresponse regulator ARR22 is a putative AHP phospho-histidine phosphatase expressed in the chalaza of developing seeds

Background

TheArabidopsisresponse regulator 22 (ARR22) is one of two members of a recently defined novel group of two-component system (TCS) elements. TCSs are stimulus perception and response modules of prokaryotic origin, which signal by a His-to-Asp phosphorelay mechanism. In plants, TCS regulators are involved in hormone response pathways, such as those for cytokinin and ethylene. While the functions of the other TCS elements inArabidopsis, such as histidine kinases (AHKs), histidine-containing phosphotransfer proteins (AHPs) and A-type and B-type ARRs are becoming evident, the role of ARR22 is poorly understood.

Results

We present evidence that ARR22 is a preferentially cytoplasmic protein, exclusively expressed in the chalaza of developing seeds. ARR22 specifically interacts with AHP2, AHP3 and AHP5 in yeast and living plant cells. Two new loss-of-function alleles,arr22-2andarr22-3, were isolated and characterized. With respect to their morphology and metabolite status, no significant difference in the developing seeds of thearr22mutants was observed compared to wild type. The genetic complementation of thearr22mutants with a genomicARR22fragment resulted in plants (arr22/gARR22) with a pleiotropic phenotype of different penetrance. This phenotype was not observed when the phosphorylatable Asp74 of ARR22 was changed to either a dominant-active Glu or a dominant-inactive Asn. The phenotype of thearr22/gARR22plants was comparable to that of multipleahk,ahpandB-type arrmutants.

Conclusion

Our results favor the model that ARR22 acts as a phospho-histidine phosphatase on specific AHPs in the cytoplasm ofArabidopsischalaza cells. The lack of any aberrant morphological and metabolite phenotype in the seeds of thearr22突变体可能表明ARR22为主responsible for the fine tuning of specific branches of chalaza-based TCS signalling. Even when slightly mis-expressed, ARR22 interferes with hormone homeostasis in non-chalaza tissues. Our data indicate that the chromatin status might play a crucial role in maintaining the chalaza-restricted expression ofARR22.

Two-component systems (TCSs) have emerged as important signal response mechanisms in higher plants [1–4］.TCSs were originally described in prokaryotic systems, where they perceive and process a wide range of environmental signals [5,6］.In plants, canonical TCSs play major roles in mediating physiological responses to hormones, such as cytokinin and ethylene [7–10], nutrients [11,12] and light [13–15] and are also important for the ethylene and H₂O₂triggered stomatal closure response [16,17］.Furthermore, TCS elements maintain the pace of the circadian clock and mediate the input of the cytokinin signal to its circadian phase [18,19］.TCS components have also been shown to be important for the regulation of several developmental processes, such as the control of the number of stem cells in the shoot apical meristem [20,21], the development of the female gametophyte [22,23], the differentiation of root vascular tissue [24–26] and the formation of root nodules duringRhizobium/plant interaction [27,28］.

Analysis of the genome ofArabidopsis thalianaand other plants has revealed sequences encoding proteins that are homologues to all three elements required to establish the complex type of two-component system and a His-to-Asp phosphorelay: the hybrid histidine kinases (AHKs), the histidine-containing phosphotransfer proteins (AHPs) and the response regulators (ARRs). The ARRs are further subdivided into three discrete groups, the A-type ARRs and B-type ARRs [29] and a novel group of ARRs consisting of ARR22 and ARR24. The receiver domains of ARR22 and ARR24 have higher similarity to the receiver domains of hybrid histidine kinases than to those of the other response regulators [30］.

The capacity of TCS proteins to act within a phosphorelay, as histidine kinases, phosphotransfer proteins, response regulators or phospho-histidine phosphatases has been demonstrated for representative members of each group [3,30］.Most of the present data can be combined to an attractive, general model of TCS signalling as it is exemplarily proposed for the cytokinin response pathway [2,4]: Upon activation by its appropriate stimulus the AHK undergoes autophosphorylation at a conserved His residue in its transmitter domain. The phosphoryl residue is then transferred to a His in the AHPsviaan Asp in the receiver domain of the AHK. The AHPs distribute the phosphoryl residue to either nucleo-cytoplasmic A-type ARRs, nuclear B-type ARRs or, as exemplarily demonstrated for AHP5, can be dephosphorylated by ARR22 in vitro.

InArabidopsis, the canonical TCS elements are encoded by multigene families. Whereas the AHP family consists of 6 members, the A-type and B-type ARRs subfamilies are each represented by 11 members. The B-type ARRs are transcription factors acting as partially redundant positive regulators of cytokinin signal transduction by modulating the expression of cytokinin response genes, includingtype-A ARRs[9,31］.Recently, Hutchinson and colleagues [7] reported that AHPs also function as partially redundant positive regulators of cytokinin signalling inArabidopsis. The A-type ARRs, however, are proposed to be partially redundant negative regulators of cytokinin signalling [15] but seem to have a more general function in the integration and coordination of several signalling processes, such as those of light [13,14], the circadian clock [18,19] and control of stem cell number [20,21］.

Despite their generally redundant function in cytokinin signalling, some members of the A-type and B-type ARRs show a highly specific expression pattern. For instance, the B-type response regulatorsARR18andARR20are expressed in developing anthers and in the tip of the pistil, respectively [32］.Comparably, the expression of the response regulatorsARR22andARR24, which form a paralogous gene pair inArabidopsis, is proposed to be restricted to the funiculus/chalaza junction in the developing seed and pollen grains, respectively [33］.Furthermore, ARR22 functions as a phospho-histidine phosphatase on phosphorylated AHP5in vitro[30］.尽管这个活动和具体的表达式,loss-of-function alleles of eitherARR22orARR24, displaying an aberrant but specific phenotype, could not be identified so far [33］.However, as reported by Kiba and colleagues [30], the ectopic expression ofARR22inArabidopsis诱导一个矮人表型不发达root system and a de-regulation of cytokinin-responsive genes. This suggests that ARR22, when mis-expressed, interferes with the cytokinin response pathway inArabidopsis[30］.

In this study we show that ARR22 is a predominantly cytoplasmic protein, whose expression is restricted to the chalaza of developing seeds. Surprisingly, the analysis of two novelarr22loss-of-function alleles, with respect to seed development, nutrient content and composition, revealed no abnormalities. The interaction of ARR22 with a subset of AHPs and the different abnormal developmental phenotypes of transgenicarr22plants complemented with a genomicARR22fragment, however, suggest that even small traces of ARR22, expressed in non-chalaza tissues, greatly disturb the plants' TCS signalling network.

ARR22is specifically expressed in the chalaza of developing seeds

To define the spatial and temporal expression ofARR22inArabidopsis, we first performed quantitative RT-PCRs using RNA from different tissues and developmental stages. The data demonstrated that theARR22transcript was only detectable in flowers and more predominantly in siliques (Fig.1A）．Subsequently, we translationally fused theARR22promoter to the GFP gene. The used 2003 bp longARR22promoter fragment covered the entire sequence 1608 bp upstream of the transcription start and 395 bp of the 5' UTR and was expected to contain all significant regulatory elements [34,35］.Confocal laser scanning microscopy (CLSM) of transgenicArabidopsisplants carrying this reporter construct indicated that GFP fluorescence was restricted to the chalaza cells of developing seeds (Fig.1B, C）．的活动ARR22promoter was first detectable in the seeds shortly after fertilization (emerging silique) and persisted through all the following developmental stages until the seed was shed. We also fused theARR22promoter fragment to theuidAreporter gene and generatedP_ARR22::uidA-containing transgenic plants. The GUS staining slightly extended to non-chalaza cells in the developing seeds. However, we could not detect specific GUS activity in organs other than the developing seeds (data not shown; [33]). To confirm the specific chalazal expression ofARR22, we performed fluorescence immunolabelling on 300–500 nm cryosections of seeds from elongating siliques (Fig.1C）．The GFP protein was only detected in the chalaza indicating the spatially and temporally restricted expression ofARR22inArabidopsis(Fig.1D）．The observedP_ARR22activity pattern is supported by recent microarray data which demonstrate the accumulation ofARR22transcript solely in developing seeds [36］.

Using theP_ARR22::GFPreporter lines, we also tested the activity of theARR22promoter in the chalaza in response to cytokinin and ethylene. For this purpose, we soaked excised inflorescences in either water or solutions containing different concentrations of cytokinin (benzyladenine) or the ethylene precursor 1-aminocyclopropane-1-carboxylic acid. At different time points after hormone application we excised the siliques and analysed the chalaza for its fluorescence intensity. However, no induction of theARR22promoter by cytokinin or ethylene was observed (data not shown).

ARR22 is predominantly localized in the cytoplasm of plant cells

We next examined the subcellular localization of wild type ARR22 and point-mutated versions in which the conserved phosphorylatable aspartate (D74) was changed to either non-phosphorylatable glutamate (E) or asparagine (N). For this purpose, we expressed wild type ARR22 fused to RFP and the modified ARR22^D74Eand ARR22^D74Nproteins fused to GFP, under the control of the constitutive Cauliflower Mosaic Virus (CaMV) 35S promoter, transiently in tobacco (Nicotiana benthamiana) leaf cells. For the verification and identification of the nuclear and cytoplasmic compartments we used B-type ARR2:GFP (nucleus; [37]), AHK5:GFP (cytoplasm and plasmalemma; [38]) and GFP (cytoplasm and nucleus) as markers. The leaves were co-infiltrated withAgrobacteriumstrains carrying either the RFP or GFP constructs and a strain conferring the expression of the silencing inhibitor genep19[39］.After transformation, the abaxial epidermis of the tobacco leaves was subjected to CLSM. We observed a strong RFP fluorescence in the cytoplasm and a weaker signal inside the nucleus indicating that ARR22 is predominantly a cytosolic protein as compared to the nuclear marker ARR2:GFP protein (Fig.2, RFP). This subcellular localization of ARR22 was not affected by the exchange of Asp74 to Glu or Asn (Fig.2）．

ARR22 interacts with a subset of phosphotransfer proteins in yeast

To identify TCS partners of ARR22 potentially involved in a chalaza-based phosphorelay, we screened for protein interactions in the yeast two-hybrid system. We cloned theARR22cDNA in the "bait" vector pGBKT7-DEST and the cDNAs of allAHPs(AHP1toAHP6) as well as the cDNA fragments encoding the histidine kinase (HK) domain of the cytokinin receptors (AHK2toAHK4) and the ethylene receptorERS1in the "prey" vector pGADT7-DEST. The HK domain of the AHKs and ERS1 was used to address the question whether ARR22, which is more similar to the receiver domains of hybrid His kinases than to the receiver region of response regulators [30], could interfere with either the hybrid His kinases or with ERS1, the only plant non-hybrid His kinase. TheBD-ARR22construct was first transformed into the yeast strain PJ69-4A and then a BD-ARR22 expressing clone was re-transfected with the preyADconstructs shown in Figure3. The interaction of the proteins was assessed by growth assay on interaction-selective media and measuringLacZreporter gene activity (β-galactosidase) (Fig.3A, B）．Although all AD fusion proteins were expressed (Fig.3C), only the yeast clones containing theAHP2,AHP3orAHP5construct together withBD-ARR22grew on interaction selective medium and displayed β-galactosidase activity above the background level (Fig.3A, B）．No interaction of ARR22 was found with AHP1, AHP4 and AHP6 and the HK domains of the histidine kinases (Fig.3）．Furthermore, ARR22 did not form homodimers in yeast (Fig.3）．

ARR22 interacts with AHP2, AHP3 and AHP5 in plant cells

To substantiate the ARR22 interactions observed in yeast, we studied protein-protein interactions in plant cells using bimolecular fluorescence complementation (BiFC; [40]). For this purpose, we generated 35S promoter-driven BiFC constructs expressing ARR22 in fusion with the C-terminal YFP fragment (YFP-C) and the AHP fusions with the N-terminal YFP fragment (YFP-N; Fig.4）．Western-blot analysis confirmed that the fusion proteins were co-expressed inN. benthamianaleaf cells in the presence of the p19 silencing inhibitor (Fig.4B）．As shown in Figure4A, a significant BiFC signal and, thus, interaction was only observed when ARR22 was co-expressed with AHP2, AHP3 and AHP5. No ARR22 interaction was observed with AHP1, AHP4 and AHP6 (Fig.4A）．Thus, in support of our yeast data, ARR22 showed specific interaction with a subset of AHPsin plantaand not with any of the other two-component signalling elements tested.

Isolation and characterization ofARR22insertion mutants

For the further analysis of theARR22function, we identified two T-DNA insertion mutant alleles of theARR22gene by screening the Cologne collection, representing 90,000 independent T-DNA insertion lines in the Col-0 ecotype [41］.Both mutant lines (arr22-2,arr22-3) contained the T-DNA insertion in the second intron of theARR22gene (Fig.5A）．In thearr22-2mutant the T-DNA was inserted 288 bp downstream of the start codon, whereas in thearr22-3line it was located 372 bp downstream of the start ATG, corresponding to a position 3 bp upstream of the 3' splicing site of intron 2 (Fig.5A）．After the isolation of homozygous lines, RNA from siliques was tested for the presence of theARR22transcript by end-point RT-PCR (Fig.5B）．In contrast to wild type, noARR22transcript was detected in either of the insertion mutant lines. The weaker band with slower electrophoretic mobility in the wild type preparation represents an additionalARR22transcript with an unspliced second intron [33］.A contamination with genomic DNA was ruled out by PCR amplification without reverse transcription which did not produceARR22amplicons. Compared to wild type, however, both mutant lines showed no aberrant phenotype with respect to their vegetative development.

Impact of the loss ofARR22function on seed development and nutrition

The function of the chalaza is to support the developing seed with nutrients [42］.Therefore, we focused our further analysis on the seeds of thearr22-2andarr22-3mutants. However, we found no microscopically detectable difference in the size and morphology of the chalaza cells between the mutants and wild type. Moreover, embryonic development was not affected inarr22-2andarr22-3, and the seeds also developed normally with respect to their size and mass (data not shown). We next investigated whether the loss ofARR22function influences the metabolic state of the developing seeds. Siliques from different developmental stages were collected, homogenized and lyophilized. The mutant and wild type siliques exhibited the identical dry mass at each developmental stage tested (Fig.6Aand data not shown). The quantification of inorganic ions using HPLC chromatography, revealed no significant difference between wild type and thearr22mutants at any developmental stage (Fig.6B, Cand data not shown). Similarly, there was no significant difference with respect to the carbohydrate and and amino acid content (Fig.7and data not shown). In conclusion, the loss ofARR22function in the chalaza has no major detectable impact on silique and seed development and the seeds' nutrient content and composition.

Complementation ofarr22 loss of functionmutants results in dwarf and sterile plants

To genetically complement the insertion mutations, we introduced a genomicARR22DNA fragment into thearr22-2andarr22-3mutant lines. TheARR22genomic fragment extended from 2003 bp upstream of the ATG start codon to 643 bp downstream of the stop codon. The T1 population of more than 200arr22-2andarr22-3transformants carrying theARR22genomic construct (gARR22) showed a broad phenotypic variation in contrast to the plants transformed with the empty vector (Fig.8）．22% of these transformants were dwarfed plants (category I), 35% had a reduced rosette size (category II) and 43% showed a normal rosette size (category III). All category I and category II plants were sterile. 78% of category III plants were sterile and 5% showed wild type fertility. 17% of category III plants had reduced fertility ranging from a few seeds to a few siliquesperplant. The growth of the siliques in these plants was arrested at an early stage of development, and the abscission of the floral organs was delayed (Fig.9A）．A similar phenotype distribution was observed when thegARR22construct was transformed into wild typeArabidopsisplants (data not shown).

Semi-quantitative RT-PCR using total RNA fom the dwarf and sterilearr22/gARR22plants revealed that there was an over-accumulation ofARR22transcript in the apical inflorescence compared to wild type (Fig.9B）．We, subsequently, compared the seed development inarr22/gARR22transgenic and wild type plants using differential interference contrast microscopy. As shown in Figure9C, the female gametophyte developed phenotypic identically in the wild type andarr22/gARR22transgenic plants. In contrast to the wild type, the fully developed female gametophyte persisted longer in thearr22/gARR22transgenic plants, the central nucleus did not divide and both synergids degenerated at the time when the floral organs were abscissed (Fig.9C）．However, the few seeds, which were occasionally produced in the siliques ofarr22/gARR22plants, were normal. In conclusion, our data suggest that a block of the fertilization, rather than a defect in early embryonic development, is the reason forarr22/gARR22plants' sterility.

The observed fertilization block was not due to a difference in pollen tube attraction because wild type andarr22/gARR22transgenic plants attracted GUS-stained wild type pollen tubes to an identical extent (data not shown). Reciprocal crossing experiments, however, revealed that the fertilisation of emasculated wild type andarr22/gARR22plants using mature anthers fromarr22/gARR22plants was not successful (Table1）．The reason for this infertility was the anthers' physical resistance and reduced ability to open and to release the pollen rather than the sterility of the pollen (data not shown). AsARR22is normally not expressed in anthers [36),观察到的表型不提供information with respect to its native function.

To address the question, whether ARR22 functions as a canonical response regulator or a histidine phosphatasein planta, we generated transgenicarr22lines expressing ARR22 variants, in which the phosphorylatable Asp74 was mutated either to Glu or Asn. A Glu mutation mimicks a phosphorylated Asp and generates a dominant-active variant of a response regulator, whereas an Asp-to-Asn mutation mimicks a non-phopshorylated version, which acts dominant-negatively. The more than 200 independentarr22plants carrying either thegARR22^D74EorgARR22^D74Nconstruct did not show any developmental abnormalities but displayed thearr22phenotype (Table1; Fig.8）．These findings indicate that ARR22 does not act as a canonical response regulatorin planta.

ARR22gene expression and intracellular localisation of ARR22

By using aP_ARR22::GFPconstruct in combination with real-time RT-PCR and GFP immunolabelling, we locatedARR22gene activity to the chalaza cells of developingArabidopsisseeds. This pattern is in general agreement with observation of Gattolin and colleagues [33], who also reportedARR22expression in the funiculus of developing seed using aP_ARR22::GUSreporter line. This difference in localisation could be due to a diffusion of the indigo stain out of the chalaza into the funiculus which we avoided in our transgenic line by using the GFP marker. Our intracellular localisation studies revealed that 35S promoter-expressed ARR22:GFP is predominantly but not exclusively located in the cytoplasm of plant cells. The mutation of the phosphorylatable Asp74 to Glu or Asn had no effect on this pattern suggesting that the phosphorylation of ARR22 does not influence its intracellular distribution.

ARR22 interacts with a subset of AHPs in yeast and plant cells

Recently, Kiba and colleagues [30] reported that ARR22 has strong phospho-histidine phosphatase activity on phosphorylated AHP5in vitro. Here we addressed the question whether ARR22 may target AHP5 only or whether it also may interact with otherArabidopsisTCS elements. Yeast two-hybrid data showed that ARR22 specifically interacts with AHP2, AHP3 and AHP5 but not with AHP1, AHP4 and AHP6 and the His kinase domains of AHK2, 3, 4 and ERS1. As indicated by the quantitative data, the interaction appears to be of low affinity and/or high kinetical dynamics. Thein plantaBiFC data substantiated the specific interaction of ARR22 with AHP2, AHP3 and AHP5 and suggest that ARR22 exerts its phospho-histidine phosphatase activity not only on AHP5 [30),但也可能AHP2和AHP3。AHP2, AHP3nd AHP5 are expressed in siliques and developing seeds [36,43] and are reported to be particularly important forArabidopsisseed development [7］.

arr22mutants show no morphological, physiological, developmental and metabolic defects

We identified two novelarr22mutant alleles and proved the absence of theARR22transcript in their siliques. In comparison to the wild type, we could not detect any difference in the number, size and morphology of the chalaza cells during embryo development and we found no difference in seed size and silique mass in the mutants. A detailed metabolic analysis of ions, amino acids and carbohydrate content in the seeds also revealed no significant difference betweenarr22mutant and wild type at any stage of seed development. These data show that ARR22 is not involved in these processes. In the view of the extremely restrictedARR22expression in the chalaza and its phospho-histidine phosphatase activity, the lack of any detectable morphological and metabolic phenotype in the seeds of thearr22mutants is surprising. A functional replacement ofARR22by its paralog,ARR24, in the chalaza is unlikely becauseARR24gene activity is only observed in pollen and anarr22/arr24double mutant also showed no phenotypic defects [33］.

Genomic complementation of thearr22mutants induces pleiotropic phenotypes

The complementation of thearr22-2andarr22-3mutants with a genomicARR22fragment (gARR22) resulted in T1 transformants with severe developmental abnormalities, such as dwarfism, delayed abscission of flower organs and a pollen release defect resulting in sterility. The inability of thearr22/gARR22anthers to release their pollen suggests a defect in the differentiation of the functional endothecium which is responsible for the rupture of the pollen sacs. The appearance of this pleiotropic phenotype depended on the presence of the phosphorylatable Asp74 [30] ingARR22and was not observed inarr22-2/gARR22^D74Nandarr22-3/gARR22^D74Etransgenic plants. This finding indicates that both the gain-of-function (ARR22^D74E) and the loss-of-function mutants (ARR22^D74N) of the response regulator have lost their biological activity. If ARR22 functions as a canonical phospho-regulated response regulator like the A-type and B-type ARRs, we would have expected to identify plants within thearr22/gARR22^D74ET1 transformant population showing a pleiotropic phenotype comparable to that of thearr22/gARR22T1 transformants. The absence of such a phenotype in thearr22/gARR22^D74E植物表明ARR22充当phospho-histidine phosphatase exclusively. This genetic finding is in accordance with the biochemical evidence that although ARR22 is able to remove the phosphoryl residue from AHP5, it does not use it for autophosphorylation [30］.

The pleiotropicarr22/gARR22phenotype is reminiscent to that ofwolallele inAHK4/CRE1gene [44,45],ahk2/ahk3/ahk4triple cytokinin receptor mutants [10,46], some higher orderahp[7] and B-typearrmutants [26］.From these data we suggest that even small traces of ARR22 in tissues, which normally do not contain the response regulator, may interfere with the hormone homeostasis and especially the cytokinin response pathway (Fig.10）．Mis-expression of ARR22 appears to have a particular negative effect on vegetative growth and possibly on the differentiation of connecting tissues such as the endothecium of the anthers. The observed dramatic developmental defects can be explained by the action of ARR22 as a very efficient AHP phosphatase and, therefore, as a strong phosphate "sink", which disturbs the two-component phosphorelay network in the extrinsic tissues (Fig.10）．Similarly, the enhanced phosphatase activity of the AHK4 receiver domain in thewolmutant is responsible for thewolphenotype [47] (Fig.10）．

An ectopic mis-expression ofARR22in the frame of a genomic fragment can occur when the transgene is inserted in transcriptionally active, more-or-less open chromatin areas, especially in 5'-promoter regions – a process which is favoured by the selection of the transgenic plants [48,49］.This suggests that the activity of theARR22locus might be under the tight control of chromatin condensation mechanisms, which restrict the expression of the response regulator to the chalaza. A similar regulation of gene activity is known for many tightly controlled developmental transformations during the plant's life cycle [50–52］.

In our study, we provide evidence that ARR22 is a predominantly cytoplasm-localised and strictly chalaza-expressed response regulator. Furthermore, we substantiate by protein-interaction and genetic experiments earlier biochemical findings that ARR22 has phospho-histidine phosphatase activity and functions on phosphorylated AHP5 and probably also on AHP2 and AHP3in vivo. However, due to the absence of any chalaza- or seed-related aberrant phenotype in thearr22mutants, the true function of ARR22 remains currently obscure. Because the slightest mis-expression in non-chalaza tissues produces "artificial" phenotypes, the use of genomicARR22fragments or binary transactivation systems, such as thepOp/LhG4orAlcR/AlcAsystem [53,54], for functional analyses of ARR22 is problematic. Therefore, the targeted replacement of the endogenousARR22gene by an (inducible) overexpression constructviahomologues recombination is probably the only possible way to determine thein plantafunction. However, under the control of a tissue-specific and/or inducible promoter, the phospho-histidine phosphatase ARR22 could be a useful tool for studying AHP2, 3 and 5-dependent TCS processes in plants.

Plant growth conditions, isolation ofARR22T-DNA mutant alleles, RT-PCR and qRT-PCR

Tobacco (Nicotiana benthamiana) andArabidopsis thaliana(Col-0)植物被种植在温室(tobacco, temperature: day 25°C/night 19°C, humidity 60%, photoperiod: 14 h;Arabidopsis, temperature: 21°C, night 18°C, humidity 45%, photoperiod: 14 h).

T-DNA mutants were isolated according to Ríos and colleagues [41] from the collection at Max-Planck Institute in Cologne. The insertion allelesarr22-2andarr22-3were identified with a T-DNA left border primer (5'-CTACACTGAATTGGTAGCTCAAACTGTC-3') andARR22specific primers (forward: 5'-CCTCGTTCTATACTAGCAGATGGGTTCGAT-3', reverse: 5'-GACTTGCATGATTTTACCTCGGACGATAAG-3') PCR products containing the T-DNA/gene junctions were cloned into pCR4-TOPO vector (Invitrogen) and sequenced.

RNA for RT-PCR was isolated using RNaqueous^®Kit (Ambion) and traces of genomic DNA were removed by TURBO DNA-free™ (Ambion). Subsequently, 1.5 μg of total RNA were reverse transcribed using oligo-dT primer with RevertAid™ H Minus M-MuLV Reverse Transcriptase (Fermentas) and resulting cDNA was used as a template for PCR with HotStart Taq polymerase (Genaxxon). PCR products were separatedviaagarose gel electrophoresis after different number of cycles for comparison withACTIN2at non-saturating conditions [55］.The sequences of the RT-PCR primers were as follows: ACT2 detF 5'-CTGCTCAATCTCATCTTCTTCC; ACT2 detR 5'-GACCTGCCTCATCATACTCG; ARR22 detF 5'-AACGATCGGAGGAATTTCTCAGACT-3'; ARR22 detR 5'-CGCTCTTCTTCTTGGTCAGCTACTGA.

For quantification ofARR22transcript, RNA and cDNA was prepared as described above with addition of random primers for reverse transcription and used as a template for qRT-PCR with Platinum Quantitative PCR SuperMix-UDG (Invitrogen) in three replicas. TaqMan^®Probes in combination with ABI PRISM 7700 (Applied Biosystems) detection system according to manufacturer recommended protocol were used to monitor the amplification. To normalize the expression data, 18S rRNA was quantified using Eukaryotic 18S rRNA Endogenous Control (VIC/TAMRA Probe) kit (Applied Biosystems) and the amplifacation efficiency ofARR22and 18S rRNA was proved to correspond. Sequences ofARR22oligonucleotides could be sent upon request.

Cloning strategy, Entry clones and site-directed mutagenesis

All clones used in our experiments were constructed using Gateway™ technology (Invitrogen). The Entry clones were either obtained via BP-reaction in pDONR201 or pDONR207 or through TOPO-reaction using the pENTR/D-TOPO vector (CTR1, AHK5; all vectors Invitrogen). The templates used to clone all genes were cDNA preparations derived fromArabidopsisroots, leaves or siliques. To avoid spontaneous mutations, the Entry clones of AHK2, AHK3, AHK4 and AHK5 were cloned and propagated in theE. colistrain CopyCutter™ (Epicentre). The reverse primers contained no stop codon to enable C-terminal fusions or a stop codon was included for N-terminal fusions. Sequences of forward and reverse primers could be sent upon request. Construction of clones containing only histidine kinase domains was performed using the full-length Entry clones of the AHKs as templates and following primers: AHK2^HK(aa562-873) – 5'-attB1-TAATGAACCGAATTGCGACAGTTGAAGAG and 5'-attB2-TTACGACGTATTTGTTTCTGCTTTCC; AHK3^HK(aa425-728) – 5'-attB1-TAATGAGTCGAATACACAAAGTTGAAGAA and 5'-attB2-TTAAGCTGGTTGCATCCCATTGGAAAATAC; AHK4^HK(aa424-743) – 5'-attB1-TAATGCACATAGTAAAAGTCGAAGATGAT and 5'-attB2-TTACGCACTGCATTTATCGCATTTCTCTAA; ERS1^HK(aa317-613) – 5'-attB1-TAATGCACGCTCGTGACCAGCTTATG and 5'-attB2-TCACCAGTTCCACGGTCTGGTTTGTGA. Site-directed mutagenesis of ARR22 was carried out on theARR22Entry clones using QuikChange^®Site-Directed Mutagenesis Kit (Stratagene) and a pair of fully complementary primers for the designed region GGCGAAGCTAGCTTCGACCTTATTCTAATGGAGAAGG containing D74E mutation andNheI restriction site or CGACCTTATTCTCATGAATAAGGAAATGCCTGAG containing D74N mutation andPagI restriction site.

Agrobacteriuminfiltration ofNicotiana benthamianaleaves, BiFC protein-protein interactions and confocal microscopy

The binary vectors for expression of the GFP/RFP fusion proteins under the control of 35S promoter were constructed via LR-reaction using the corresponding Entry clones and destination vectors pH7FWG2.0, pH7WGF2.0 and pB7RWG2.0 [56］.The p19 protein from tomato bushy stunt virus cloned in pBIN61 [57] was used to suppress gene silencing. All vectors were transformed inAgrobacterium tumefaciensstrain GV3101 pMP90 and prior infiltration resuspended in AS-medium (10 mM MgCl2, 150 μM acetosyringone and 10 mM MES pH 5.7) to OD₆₀₀0.8 according to Grefen and colleagues [58] Abaxial epidermis of infiltrated tobacco leaves was assayed for fluorescence by CLSM 2–3 days post infiltration. For BiFC theAHPcDNAs were recombinedviaLR-reaction into pSPYNE-35S andARR22into pSPYCE-35S [40] and infiltrated to the tobacco leaves as described elsewhere [58］.The expression of the BiFC fusions was determined by SDS-PAGE and western blot using the tissue of transfected leaves according to Walter and colleagues [40］.

Protein-protein interactions in yeast two-hybrid system

Yeast two-hybrid experiments were performed using the Matchmaker™System (Clontech). Plasmids were constructed by LR-reaction of corresponding Entry clones and destination vectors pGBKT7-DEST or pGADT7-DEST. Yeast strain PJ69-4A was transformed using lithium acetate/SS-DNA/PEG method [59］.经过3天的增长啊n vector selective media (CSM-L^-, W^-), 5 independent clones were pooled and propagated to an OD₆₀₀1.0 in liquid, vector-selective media. Subsequently, 7.5 μl of culture were dropped on vector- and interaction-selective media (CSM-L^-, W^-, Ade^-) and incubated at 28 C. At day 2 the growth of the clones was monitored. In addition, liquid yeast cultures were harvested and analyzed by western-blot to determine the correct expression of the fusion proteins [59］.Activity of β-galactosidase activity was measured using 3 independent yeast clonespertransformation. 50 ml yeast culture was grown in vector-selective media to OD₆₀₀2.0, harvested and lysed using freeze-thaw method and vortexing with glass beads in 700 μl of Z-buffer (60 mM Na₂HPO₄, 40 mM NaH₂PO₄, 10 mM KCl, 1 mM MgSO₄, pH 7.0). The total protein amount of the lysate was quantified by Bradford protein assay and β-galactosidase activity measured according to Grefen and colleagues [59］.

Generation and analysis ofARR22子:GFP线和GFP immunolabelling

ARR22promoter DNA fragment was amplified fromA. thalianagenomic DNA using Phusion™ polymerase (Finnzymes) and the primers ARR22pF 5'-attB1-GCAGCAGATGACTTAACTCTCCA, ARR22pR 5'-attB2-GGGTACCTCCGGTGGATTTTGT. The promoter fragment was cloned into pDONR207viaBP-reaction and verified by sequencing. The fragment comprises the region 2003 bp upstream of the start codon including the first 27 bp of theARR22coding sequence. The fragment was translationally fused to theGFPreporter gene via LR-reaction in the destination vector pMDC107 [60], and the construct transformed in theAgrobacterium tumefaciensstrain GV3101 pMP90.Arabidopsisplants were transformed using the flower-dipping method. For selection of transgenic plants, seeds were vapor sterilized as described in Grefenet al[58] and T1 seedlings selected for hygromycin resistance in a growth chamber at 21°C under long-day conditions for 14 days on 0.5× Murashige-Skoog medium supplemented with 1% (w/v) sucrose, 0.8% (w/v) phytoagar and 25 μg/ml hygromycin B. Resistant plants were propagated on soil and siliques from several independent transgenic lines (T2) were tested for fluorescence by CLSM.

For GFP imunolabelling, seeds were fixed for 90 min in 4% (v/v) formaldehyde in MTSB, pH 7.0, followed by a treatment with 8% (v/v) formaldehyde in MTSB for additional 90 min, then infiltrated with a mixture of sucrose and polyvinyl pyrrolidone [61] and frozen in liquid nitrogen. 300–500 nm cryo-sections were cut at -80°C, mounted on coverslips, labelled with a rabbit anti-GFP antibody (diluted 1:250 in blocking buffer; Abcam) and a goat anti-rabbit antibody coupled to Cy3 (diluted 1:400 in blocking buffer; Dianova) for 1 h, each. Nuclei were stained with DAPI. Cryo-sections were embedded in Moviol for microscopy. In the control, the rabbit anti-GFP antibody was omitted. Labeled cryo-sections were viewed with a Zeiss Axiophot light microscope (63×/1.4 oil immersion objective).

HPLC analysis ofarr22mutant siliques

For sample preparation as well as for analytics Milli-Q water and chemicals in highest purity were used exclusively. The siliques were collected in five replicas for each line at the developmental stage, where the first senescing siliques appeared on the inflorescences, frozen in liquid nitrogen, homogenized and lyophilized. To 50 mg lyophilized sample 750 μl of a chloroform/methanol/water [5/15/3 (v/v/v)] mixture were added, mixed and afterwards centrifuged for 5 minutes at 14.000 rpm and 4°C. 400 μl of the supernatant were transferred into a new vial and pooled with another 400 μl obtained by similar treatment of a second replicate of the same sample. To the 800 μl pooled supernatant 8 μl of a 2.5 mM norleucin solution were added as internal standard for the amino acid analysis. After thorough mixing 376 μl water and 250 μl chloroform were added, mixed and afterwards centrifuged as described before. 900 μl supernant were collected without touching the interface, evaporated to dryness and redissolved in a mixture of 400 μl water and 600 μl acetonitrile. Undissolved residues were removed by centrifugation (30 seconds,14.000 rpm, 4°C). The supernatant was transferred into a new vial and again evaporated to dryness. The pellet was redissolved in 400 μl water. Further workup of the sample was done by solid phase extraction (SPE) with Sep-Pac C₁₈columns (Waters). For this SPE columns were washed with 1 ml acetonitrile followed by 1 ml water for column equilibration. Then the sample was loaded onto the SPE column and eluted with 500 μl water. Vacuum was used to collect the entire liquid of the column. Resulting 900 μl eluate were evaporated to dryness afterwards. For amino acid analysis the resulting pellet was dissolved in 100 μl lithium diluent. For sugar and ion analytics pellets were dissolved in 100 μl water. If necessary, storage of samples was done at – 20°C. Before analysis samples were filtered through a 0.5 μm PVDF filter. For amino acid analysis ninhydrin post column derivatization technology was used. The modular HPLC system consisted of two high pressure pumps, autosampler, and UV/Vis – detector from Kontron/BioTek. For post column derivatization Pickering Laboratories ninhydrin pump, column oven and reactor were used. UV/Vis detection of the amino acid derivatives was done at 440 and 570 nm. For amino acid separation the lithium cation exchange column from Pickering Laboratories (4 × 100 mm, particle size: 5 μm) was used with the following ternary gradient at a flow rate of 340 μl/min. 0 min: 100% A (96.0% H₂O, 0.7% lithium citrate, 0.6% lithium chloride, pH 2.8) 12 min: 100% A 48 min: 35% B (97% H₂O, 0.9% Lithium citrate, 2.0% lithium chloride, pH 7.5) 90 min: 100% B 95 min: 100% B 120 min: 94% B and 6% C (99% H₂O, 0.6% lithium chloride, 0.4% lithium hydroxide, pH 11.8) 150 min: 94% B and 6% C. For Ion analysis a Dionex DX120 system equipped with suppressed conductivity detection was used in isocratic mode. For cation separation an Ion Pac-CS12A column (4 × 250 mm) was eluted with 20 mM methansulfonic acid at a flow rate of 1 ml/min. Anions were separated on an Ion Pac AS 9-HC column (4 × 250 mm) with 9 mM sodium carbonate as mobile phase at a flow rate of 1 ml/min. For carbohydrate analysis a Kontron/BioTek HPLC system equipped with an electrochemical detector (Bischoff) was used for high pH anion exchange chromatography (HPAEC). Isocratic separation was done on a CarboPac PA1 column (4 × 250 mm) from Dionex. For elution a 30 mM sodium hydroxide solution was used at a flow rate of 0.80 ml/min.

Complementation ofarr22-2andarr22-3mutants

A DNA fragment containing theARR22gene was amplified fromArabidopsisgenomic DNA using Phusion™ polymerase (Finnzymes). The forward primer used previously for the cloning of theARR22promoter was combined with the reverse primer ARR22gR (5'-attB2-CCCTATCTTCTTAATGACATATAGTATTGG-3'), and the obtained DNA fragment comprising the region 2003 bp upstream of the ATG start codon and 643 bp downstream of the stop codon was cloned into pDONR207viaBP-reaction and verified by sequencing. Site-directed mutagenesis of Asp74 was carried out on the Entry clone as described above. All DNA fragments were recombinedviaLR-reaction into destination vector pMDC123 [60］.Thearr22-2andarr22-3lines were transformed as described above and transgenic seedlings selected on soil by spraying with 0.05% (v/v) BASTA. Transgenic T1 plants were sorted to different phenotypic categories, photographed and siliques or upper parts of inflorescences were collected and tested for theARR22transcript amount by RT-PCR (see above). For microscopy of developing seeds, the inflorescences were submerged in ethanol:acetic acid (3:1) fixation solution for several hours. Subsequently, the tissue was rehydrated for 30 min in a series of 70%, 50% and 20% (v/v) ethanol followed by 20 min incubation in a clearing solution consisting of chloral hydrate : water : glycerol mixture (8:3:1 w/w). Seeds were excised from the siliques and mounted on slides in clearing solution for differential interference contrast microscopy.

Microscope image acquisition

CLSM was performed using a Leica TCS SP2 confocal microscope (Leica Microsystems GmbH). All CLSM images were obtained using Leica Confocal Software and the HCX APO LW 20×/0.5 or the HCX PL APO 63×/1.2 W water-immersion objective. GFP and RFP channels were acquired by simultaneous scanning using 488-/568-nm laser lines for excitation. The signals were detected between 500–530 nm for GFP and 590–630 nm for RFP. YFP signal was detected between 550 and 580 nm after excitation by 488 nm laser. Microscopy of developing seeds was carried out using a Nikon Eclipse 90i microscope equipped with a 40×/0.75 objective and a CCD camera applying differential interference contrast. The images were acquired using MetaMorph software (Molecular Devices) and processed using Adobe Photoshop 9.0.

We are grateful to Dr. Rita Gross-Hardt for her introduction in seed microscopy, Dr. Dierk Wanke for helpful comments and Felicity de Courcy for proofreading the manuscript. This work was supported by DFG grants to Klaus Harter (AFGN/HA 2146/5; SFB446/A23).

Affiliations

1. Zentrum für Molekularbiologie der Pflanzen/Pflanzenphysiologie, Universität Tübingen, Auf der Morgenstelle 1, Tübingen, D-72076, Germany

   Jakub Horák, Christopher Grefen, Kenneth W Berendzen, Achim Hahn, Bettina Stadelhofer, Mark Stahl & Klaus Harter

2. Zentrum für Molekularbiologie der Pflanzen/Mikroskopie, Universität Tübingen, Auf der Morgenstelle 3, Tübingen, D-72076, Germany

   York-Dieter Stierhof

3. Max Planck Institut für Züchtungsforschung, Carl-von-Linné-Weg 10, Köln, D-59829, Germany

   Csaba Koncz

Corresponding author

Correspondence toKlaus Harter.

Authors' contributions

JH performed most of the cloning, the molecular and cell biological expression studies, the intracellular distribution and BiFC experiments, the detailed molecular characterization of thearr22T-DNA insertion mutants and generated and characterized thearr22/gARR22transgenic lines. Furthermore, JH prepared the samples for the HPLC analyses, prepared the figures and helped to draw the manuscript. CG cloned the yeast two-hybrid constructs, performed the yeast two-hybrid analysis and intensively discussed with JH the experiments. KWB carried out the initial identification of thearr22mutants in the Cologne collection. AH constructed the Gateway-compatible yeast two-hybrid vectors. Y–DS did the immunolabelling experiments. BS and MS performed the HPLC analyses. CK provided the Cologne seed collection and helped to draft the manuscript. KH conceived and coordinated study and drafted the manuscript. All authors read and approved the final manuscript.

Open AccessThis article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and Permissions